Review



pmxs ires gfp gift  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc pmxs ires gfp gift
    Pmxs Ires Gfp Gift, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs ires gfp gift/product/Addgene inc
    Average 94 stars, based on 55 article reviews
    pmxs ires gfp gift - by Bioz Stars, 2026-02
    94/100 stars

    Images



    Similar Products

    pmxs ires gfp gift  (Addgene inc)
    94
    Addgene inc pmxs ires gfp gift
    Pmxs Ires Gfp Gift, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs ires gfp gift/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    pmxs ires gfp gift - by Bioz Stars, 2026-02
    94/100 stars
    		  Buy from Supplier
    c myc  (Addgene inc)
    94
    Addgene inc c myc
    C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c myc/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    c myc - by Bioz Stars, 2026-02
    94/100 stars
    		  Buy from Supplier
    pmx retroviral vectors c-myc  (Addgene inc)
    90
    Addgene inc pmx retroviral vectors c-myc
    A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).
    Pmx Retroviral Vectors C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmx retroviral vectors c-myc/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pmx retroviral vectors c-myc - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    pmxs-c-myc  (Addgene inc)
    90
    Addgene inc pmxs-c-myc
    A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).
    Pmxs C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs-c-myc/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pmxs-c-myc - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    ldha acgatcagcagcttgcagtg idt n a recombinant dna pmxs c myc addgene plasmid  (Addgene inc)
    98
    Addgene inc ldha acgatcagcagcttgcagtg idt n a recombinant dna pmxs c myc addgene plasmid
    A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).
    Ldha Acgatcagcagcttgcagtg Idt N A Recombinant Dna Pmxs C Myc Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ldha acgatcagcagcttgcagtg idt n a recombinant dna pmxs c myc addgene plasmid/product/Addgene inc
    Average 98 stars, based on 1 article reviews
    ldha acgatcagcagcttgcagtg idt n a recombinant dna pmxs c myc addgene plasmid - by Bioz Stars, 2026-02
    98/100 stars
    		  Buy from Supplier
    pmxs myc plasmid  (Addgene inc)
    93
    Addgene inc pmxs myc plasmid
    A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).
    Pmxs Myc Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs myc plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pmxs myc plasmid - by Bioz Stars, 2026-02
    93/100 stars
    		  Buy from Supplier
    pmxs c myc  (Addgene inc)
    93
    Addgene inc pmxs c myc
    A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).
    Pmxs C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmxs c myc/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pmxs c myc - by Bioz Stars, 2026-02
    93/100 stars
    		  Buy from Supplier
    cmyc  (Addgene inc)
    93
    Addgene inc cmyc
    A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).
    Cmyc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cmyc/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    cmyc - by Bioz Stars, 2026-02
    93/100 stars
    		  Buy from Supplier
    pcl eco addgene  (Addgene inc)
    93
    Addgene inc pcl eco addgene
    A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).
    Pcl Eco Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcl eco addgene/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pcl eco addgene - by Bioz Stars, 2026-02
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).

    Journal: Frontiers in Cell and Developmental Biology

    Article Title: Human stem cell models for Marfan syndrome: a brief overview of the rising star in disease modelling

    doi: 10.3389/fcell.2024.1498669

    Figure Lengend Snippet: A summary of all established human pluripotent stem cell lines for Marfan syndrome that are described in peer-reviewed articles, or deposited in online stem cell registries, being NIH stem cell registry and hPSC registry. For each line, the pathogenic variant and patient information is summarized, if available. Also, original cell source, cell types obtained by directed differentiations for disease model, method of reprogramming, availability of isogenic (ISO) control, the generator of the line and the year of publication or deposition. Abbreviations: NA (not available), United States (United States of America).

    Article Snippet: MFSiPS cell line (proband FB1592) , Frameshift variant c.1642del3ins20bp , Severe reduction in FBN1 expression , Fibroblast , Osteogenic and chondrogenic fates , pMX retroviral vectors SOX2 , OCT4 , KLF4 , and c- MYC (Addgene) , No , Stanford University (United States) , 2012 , .

    Techniques: Variant Assay, Control, Transduction, Retroviral, Expressing, Dissection, Plasmid Preparation, CRISPR, TALENs, Knock-Out, Virus, Functional Assay, shRNA, Biomarker Discovery

    Summary of in vitro cellular models for Marfan syndrome established with pluripotent stem cells to model various aspects of the disease, including aortopathy, skeletal phenotype and Marfan-related cardiomyopathy.

    Journal: Frontiers in Cell and Developmental Biology

    Article Title: Human stem cell models for Marfan syndrome: a brief overview of the rising star in disease modelling

    doi: 10.3389/fcell.2024.1498669

    Figure Lengend Snippet: Summary of in vitro cellular models for Marfan syndrome established with pluripotent stem cells to model various aspects of the disease, including aortopathy, skeletal phenotype and Marfan-related cardiomyopathy.

    Article Snippet: MFSiPS cell line (proband FB1592) , Frameshift variant c.1642del3ins20bp , Severe reduction in FBN1 expression , Fibroblast , Osteogenic and chondrogenic fates , pMX retroviral vectors SOX2 , OCT4 , KLF4 , and c- MYC (Addgene) , No , Stanford University (United States) , 2012 , .

    Techniques: In Vitro, Variant Assay, Knock-Out, Expressing, Over Expression, Activation Assay, Control, Phospho-proteomics